CLONING AND SEQUENCING OF A PUTATIVE POSITIVE TRANSCRIPTION REGULATOR GENE OF LANDOMYCIN E BIOSYNTHETIC GENE CLUSTER OF STREPTOMYCES GLOBISPORUS 1912

K. Pankevych*, H. Kruegel**, V. Fedorenko*

*Ivan Franko National University of L’viv,

Hrushevskoho st. 4, L’viv 79005, Ukraine

**Hans-Knoell-Institut for Natural Product Research,

Beutenbergstrasse, 11, Jena 07745, BRD

 

Regulation of antibiotic biosynthesis in streptomycetes is carried out at the global level of secondary metabolism as well as the level of certain biosynthetic pathway. Genes of specific regulatory proteins required for activation of structure genes were identified in biosynthetic clusters for actinorhodin (actII-ORF4) [2] and undecylprodigiosin (redD) [9] of Streptomyces coelicolor A3(2), daunorubicin (dnrI) of S. peucetius [12] and jadomycin (jadR1) S. venezuelae [3]. These proteins belong to the large group of two-component regulatory systems. The family of regulatory proteins of two-component sensory transduction systems activates transcription from s70-dependent promoters in E. coli (or their equivalents in other organisms) of specific target genes [11]. During such adaptative response to certain changes of intra- or extracellular environment, these regulators are phosphorylated by specific sensors – histidine protein kinases. In this case, a site of phosphorelation is a highly conservative aspartat residue. Phosphorylated effector activates transcription from the promoters of target genes.

We studied biosynthetic gene cluster of new potential antitumor polyketide antibiotic of angucycline group landomycin E (lnd) in its producer S. globisporus 1912. By means of partial sequencing of genomic library fragments hybridizing with molecular probe represented by amplified in polymerase chain reaction conservative sequence of polyketide synthase gene, we identified 23 genes, probably involved in landomycin E biosynthesis [10]. As a result of comparison of nucleotide sequences of these genes and amino acid sequences of their putative translation products with DNA and protein data bases, we found the highest homology with landomycin A biosynthetic gene cluster (lan) of S. cyanogenus S136 [14]. Although gene clusters for landomycines E and A were found to be similar, we revealed some differences. One of such differences was DNA-sequence present in lnd-cluster and not found in lan-cluster which demonstrated similarity to the sequences of positive transcription regulator genes. The aim of our investigation was cloning and complete sequencing of a putative positive transcription regulator gene of landomycin E biosynthetic gene cluster of  S. globisporus 1912 and comparative analysis of the amino acid sequence of its translational product with known proteins.

We used DNA fragment of S. globisporus 1912 genomic library cloned in recombinant phage vector lGEM1.8. Region of chromosomal DNA between restriction sites EcoRI(6) and SmaI(9) (Fig.1), where, according to the partial sequencing and comparison to the data base, the putative regulator gene lndI had been mapped, we completely sequenced. The complete nucleotide sequence of 1515 bp-fragment is shown at Fig.2. Computer assisted analysis of DNA sequence using DNASIS revealed an open reading frame (ORF) of 291 codons, named lndI, with initiation codon ATG at position 288 and termination codon TAG at position 1071. As a result of comparison of deduced amino acid sequence of the ORF with protein data base, we found out that putative LndI was similar to the large family of regulatory proteins of bacterial two-component sensory transduction systems. Usually, genes encoding both proteins of the two-component system – regulator and specific protein kinase – are linked, e.g. afsQ1-afsQ2 S. coelicolor A3(2) [4], cutR-cutS S. lividans 66 [13], phoP-phoR B. subtilis [6] and ompR-envZ E. coli [8]. Nevertheless, analysis of upstream and downstream DNA regions (287 bp and 445 bp, respectively) revealed no homology to any histidine protein kinase encoding genes. Since the sensory proteins are not so conserved as regulators, we failed to identify a putative gene, probably, due to the short stretch of analised sequences.

Gene lndI, like other SARP-encoding (Streptomyces Antibiotic Regulatory Protein) genes [15], contained rare for GC-rich streptomycete DNA codon TTA (Leu8), that was found only in antibiotic resistance genes and regulatory genes of secondary metabolism [5]. LndI demonstrated 59% identity and 69% similarity to JadR1 - a  pathway-specific positive transcription regulator of jadomycin biosynthetic genes of S. venesuelae, 38% and 60% - to transcription regulator of phosphate regulon B. subtilis PhoP, 38% and 56% - to transcription regulator of phosphate regulon E. coli PhoB, 34% and 49% - to CreB regulating catabolism in E. coli, 34% and 48% - to AfsQ and other putative regulators of secondary metabolism in S. coelicolor A3(2), 33% and 47% - to osmoregulator E. coli OmpR, and 31% and 46% - to transcription regulator of copper metabolism in S. lividans 66 CutR. Fig.3 shows a multiple alignment of deduced amino acid sequence of LndI with 16 regulatory proteins of two-component bacterial sensory transduction systems, performed by CLUSTAL.

Fig. 1. Restriction map of the DNA fragment of S. globisporus 1912 lnd-cluster containing lndI gene. The location of lndI is indicated by arrow. Bold line shows a genomic library fragment used for subcloning. Thin lines represent DNA fragments used for sequencing. pKM2 contained 2.4 kb SacI-BamHI fragment, pKM3 – 0.7 kb EcoRI-BamHI fragment, pKK1 – 1.3 kb BamHI-EcoRV fragment and pKK2 – 0.8 kb BamHI-SalI fragment of lGEM1.8 inserted in respective restriction sites of polylinker of pBluescriptIIKS+

On the base of the similarity of deduced amino acid sequence of LndI to known proteins, we suggest that the putative positive transcription regulator of landomycin E biosynthetic cluster has common stuctural features with other members of two-component regulatory proteins family. Namely, N-terminus of LndI contained highly conservative aspartate residue (Asp87), that in other systems undergoes specific phosphorylation by histidin protein kinase. Characteristic of the family of regulatory proteins is the structure of their C-terminal part, that binds DNA of target gene promoters, interacts with RNA polymerase and is responsible for dimerisation of the protein itself. This small (ca. 98 aa) portion of the protein has a specific structure determined for OmpR, that provides transcription regulation of E. coli porine genes ompC and ompF [8]. It has three a-helices and two antiparallel b-sheets. Two a-helices - a2 and a3 - and a linking loop (5-12 aa in different proteins) forms typical “helix-turn-helix” structure. The multiple alignment of deduced amino acid sequence of LndI with other regulatory proteins suggested that the positive transcription regulator of lnd-cluster could form a-helices in regions corresponding to those in OmpR: a1(199-212), a2(220-229) and a3(242-256) (see Fig.3). In case of LndI the loop, linking a2 and a3, consisted of  7 amino acid residues. In the structure of LndI we could also suggest b-sheets: b1(175-177), b2(179-183), b3(188-192), b4(194-196), b5(217-218), b6(263-267) and b7(270-276).

 

    1 GAATTCTTGTTGTTCTTGCCCCAGATGCACTTTATCCCCTTCCTGCGACCGGCGGCGAAC 60

   61 CACCGGAAATTGATCTCGATCTCTACATAGGCGTCAATTCGCGGCCGTAGAGAGGGCTCG 120

  121 CGAAGAGGTCGCCGCCGACCCGTCACTCTGCGTGTGCCTGGGTGCCGGTATTTGGCGAAT 180

  181 AAACTTCCTGTGACATATGTCATAAATCATTTGACAAACCGTCGCGCAGTTTTGTAGTTT 240

  241 TTTGATCACGGTGATGGCAGCACGTTCGGCGAATCGGGGGTAGTAAATGAGACGGCAGTC 300

                                                    M  R  R  Q  S 

  301 TGCAAACTTACTCATACTTCGCACACCGTGTAGCAGTGAAGGGTCGGAGTTCGAGGCTAA 360

       A  N  L  L  I  L  R  T  P  C  S  S  E  G  S  E  F  E  A  N 

  361 TGCCAATTCGCGCACCCCTCAGCAGGCCAGTCGCGCGCAAAATGATGTACTCAATGTCCT 420

       A  N  S  R  T  P  Q  Q  A  S  R  A  Q  N  D  V  L  N  V  L 

  421 CGTCGTGGAAAGTGACGCCTGTTCTGCCGATTCGCTTGTCCAGAAGCTTCGTCGGCACGG 480

       V  V  E  S  D  A  C  S  A  D  S  L  V  Q  K  L  R  R  H  G 

  481 CTACCGGGCTGCCAGTGTCGCGACGGGAGCCAAGGCATTGCAGGCACACCGCAGCGCCGA 540

       Y  R  A  A  S  V  A  T  G  A  K  A  L  Q  A  H  R  S  A  D 

  541 CCTAGTTCTCCTCGACCTCGACCTGCCGGATCTCGACGGGCTGGAGGTGTGTCGCGCGAT 600

       L  V  L  L  D  L  D  L  P  D  L  D  G  L  E  V  C  R  A  I 

  601 AAGGGCCGACGCCGATACTCCCGTCATCGCCATTACCGCGCGGGACAGCGAACTCGACCG 660

       R  A  D  A  D  T  P  V  I  A  I  T  A  R  D  S  E  L  D  R 

  661 TGTTCTCGGTCTGCAGGCGGGCGCCGACGATTACATGGCCAAGCCGTACGGTTTCCGGGA 720

       V  L  G  L  Q  A  G  A  D  D  Y  M  A  K  P  Y  G  F  R  E 

  721 ATTGATGGCCCGAATAGAAGCAGTCATGCGAAGATTCCGCCCTCAGCAGCGAGCGCTTCA 780

       L  M  A  R  I  E  A  V  M  R  R  F  R  P  Q  Q  R  A  L  Q 

  781 ACAGGTCATCGTGCACGGACCGCTGCACATTGACGCGGGTAAACGCGAAATTCGATTGCA 840

       Q  V  I  V  H  G  P  L  H  I  D  A  G  K  R  E  I  R  L  H 

  841 CCAGGTGCCGGTCGATGTGACCCGCAAGGAGTTCGGCCCTTCTTACCTGCTGGCGTCCCA 900

       Q  V  P  V  D  V  T  R  K  E  F  G  P  S  Y  L  L  A  S  H 

  901 TCCGGGGAGCATCGTCTCGCGCAAGCAGTTGATGACCCAGGTGTGGGAGGACCCCGGATC 960

       P  G  S  I  V  S  R  K  Q  L  M  T  Q  V  W  E  D  P  G  S 

  961 CCGGCCGGGACGCACGATCGACACGCATGTCAGCAGCCTGCGCAACAAGCTCGGATCCAG 1020

       R  P  G  R  T  I  D  T  H  V  S  S  L  R  N  K  L  G  S  S 

 1021 CAACTGGATTATATCGGTGCGTGGCGTCGGCTTCCGGCTCGGATCTCCGTAGACGGCGCT 1080

       N  W  I  I  S  V  R  G  V  G  F  R  L  G  S  P  * 

 1081 GGGCAGGCCCAATGCCGAGGGGCGAGGGCCGGCGCGACCGGCGACTTTCGAAGCATCCGT 1140

 1141 GCCACTGACGGGGTGATGGCGGCGCGAGCGCGACGTCAGCGAAGCACCCGTGCCGCTGAG 1200

 1201 AGATGTTCGGTCATGCTCGCACTCGAGCGGCAACATGGTGCCTTCGCGGGGGTCATCGCG 1260

 1261 GTCCTCGCCGCAGCTCGACCTGCACCATGGTGCAGTCGAGGGGGAGCATGGCGCACTGAA 1320

 1321 CAGGGTCGCCGCCGCCAGGTTCACCTCACCCTGGATCGACGCAACGTCGTCGACCAGGAT 1380

 1381 CACGTGAACAGCGGCCAGGGGTCCAGCAGGCTCACCGTCGCCCGGACATCGACCTCCGCC 1440

 1441 GTCGTCGACAGGACGCGTGACGCGCCGAGCGGTCCAGCGCCTGACTGCCACTGCTGCTCA 1500

 1501 TCTGGCGTGGCGGTA 1515

 

Fig. 2. Nucleotide and deduced amino acid sequences of 1.5 kb segment of DNA containing lndI. Translational start codon is underlined. Asteric indicates stop codon

Fig. 3. Multiple alignment of deduced amino acid sequence of LndI with 16 regulatory proteins of bacterial two-component sensory transduction systems. Boxes indicate amino acid residues forming a-helices and b-sheets

* name of a protein.

** strain: Sgl – S. globisporus 1912; Sve – S. venesuelae; Eco – E. coli; Atu – Agrobacterium tumefaciens; Sli – S. lividans; Sty – Salmonella typhimurium; Rca – Rhodobacter capsulatus; Sco – S. coelicolor; Bsu – B. subtilis; Efa – Enterococcum faecium.

Fig. 3. Conclusion

 

Comparative analysis of deduced amino acid sequence of LndI with the family of two-component transcription regulators revealed in the positive regulator of lnd-cluster conserved residues responsible for DNA binding: Thr(199) in a1-helix, Arg(219) between b5-sheet and a2-helix, Thr(242), Val(245), Lys(253) and Leu(254) in a3-helix.

Concerning the interaction with RNA polymerase, the regulatory proteins of two-component sensory transduction systems fall into two groups. The first group, as OmpR E. coli, interacts with a-subunit of RNA polymerase [1], the second group, as PhoB E. coli, interacts with s-subunit [7]. Investigations of defective mutants in regulatory proteins that lacked the ability to activate trancription from specific promoters had revealed amino acid residues responsible for the interaction with the subunits of RNA polymerase. It had been found out that interaction with a-subunit was carried out by Arg(230), Ala(234) and Glu(236) residues of OmpR, while the interaction with s-subunit was provided by Trp(227)of PhoB E. coli. Since LndI, like PhoB, contained at corresponding site Trp(227) and neither of residues required for the interaction with a-subunit, we suggest, that the putative positive regulator of lnd-cluster interacts s-subunit of RNA polymerase S. globisporus1912. This suggestion was also supported by the evidence that a similarity score of LndI to PhoB was higher then to OmpR (identity 38% and 33%, respectively).

Common features identified by the multiple alignment of deduced amino acid sequence of LndI with characterized transcription regulators of bacterial two-component sensory transduction systems assigned the function of LndI as a putative positive transcription regulator of landomycin E biosynthetic gene claster of S. globisporus 1912.

____________________

 

1.          Bowrin W., Brissette R., Kangla T. et al. The a subunit of RNA polymerase specifically inhibits expression of the porin genes ompF and ompC in vivo and in vitro in Escherichia coli // FEMS Microbiol. Lett. 1994. Vol. 115. P. 1–6.

2.          Fernandez-Moreno M.A., Caballero J.L., Hopwood D.A. at al. The act cluster contains regulatory and antibiotic export genes, direct targets for transcriptional control by the bldA transfer RNA gene of Streptomyces // Cell. 1991. Vol. 66. P. 769–780.

3.          Han L., Yang K., Ramalingam E. et al. Cloning and characterization of polyketide synthase genes for jadomycin B biosynthesis in Streptomyces venezuelae ISP5230 // Microbiology. 1994. Vol. 140. P. 3379–3389.

4.          Ishizuka H., Horinouchi S., Kieser H.M. et al. A putative two-component regulatory system involved in secondary metabolism in Streptomyces spp // J. Bacteriol. 1992. Vol. 174. P. 7585–7594.

5.          Leskiw B.K., Bibb M.J.,Chater K.F. The use of a rare codon specifically during development // Mol. Microbiol. 1991. Vol. 5. P. 2861–2867.

6.          Liu W., Hulett F.M. Bacillus subtilis PhoP binds to the phoB tandem promoter exclusively within the phosphate starvation-inducible promoter // J. Bacteriol. 1997. Vol. 179. P. 6302–6310.

7.          Makino K., Amemura M., Kawamoto T. et al. DNA binding of PhoB and its interaction with RNA polymerase // J. Mol. Biol. 1996. Vol. 259. P. 15–26.

8.          Martinez-Hackert E., Stock A.M. The DNA-binding domain of OmpR: crystal structure of a winged helix transcription factor // Structure. 1997. Vol. 5. P. 109–124.

9.          Narva K.E., Fietelson J.S. Nucleotide sequence and transcription analysis of the redD locus of  Streptomyces coelicolor A3(2) // J. Bacteriol. 1990. Vol. 172. P. 326–333.

10.       Pankevych K., Demydchuk J., Luzhetsky A. et al. Pathway alignment and analysis of the landomycin E biosynthetic gene cluster from Streptomyces globisporus 1912 // VAAM, Dresden, 1999.

11.       Pao G.M., Saier M.H. Response regulators of bacterial signal transduction systems: selective domain shuffling during evolution // J. Mol. Evol. 1995. Vol. 40. P. 136–154.

12.       Tang L., Grimm A., Zhang Y.-X. et al. Purification and characterization of the DNA-binding protein DnrI, a transcriptional factor of daunorubicin biosynthesis in Streptomyces peucetius // Mol. Microbiol. 1996. Vol. 22. P. 801–813.

13.       Tseng H.-C., Chen C.W. A cloned ompR-like gene of Streptomyces lividans 66 suppresses defective melC1, a putative copper-transfer gene // Mol. Microbiol. 1991. Vol. 5. P. 1187–1196.

14.       Westrich L., Domann S., Faust B. et al. Cloning and characterization of a gene cluster from Streptomyces cyanogenus S136 probably involved in landomycin biosynthesis // FEMS Microbiol. Lett. 1999. Vol. 170. P. 381–387.

15.       Wietzorrek A., Bibb M. A novel family of proteins that regulates antibiotic production in streptomycetes appears to contain an OmpR-like DNA-binding fold // Mol. Microbiol. 1997. Vol. 25. P. 1177–1184.